Both T alni ss and T occidentalis have been reported in Alaska... not sure which this is.
Leaf galls on Populus tremuloides
On Populus tremuloides. Double layered leaf galls (secondary fold/gall inside).
Guess on ID.
Emerged from galls collected on 06/05/23
see https://bugguide.net/node/view/326810.
This is the only species of Abia known in North America. There are 6 records of A americana in ARCTOS
On Aronia melanocarpa (planted in 2021, purchased commercially)
Roughly inch long caterpillar found on-top of a local mountain in a wind swept area that is currently clear of snow. It was alive and seemed to be basking in the sun. Daytime temps up to around freezing and night time around -5 f.
I have never seen a pink caterpillar like this before. iNat wants to call it a sawfly but I did not think sawfly larvae had legs along their entire length.
About 20 mm long
Host is balsam poplar .LifeScanner returned Phyllocolpa excavata as ID. BOLD-C48, DNA barcode: COI-5P
AACATTATATTTTATTTTAGGATTTTGATCAGGAATACTAGGATTATCATTTAGAATATTAATCCGAACAGAATTAGGAATACCCGGATCAATAATTGGAGATGATCAAATTTATAATGTAATTGTAACATCTCATGCATTTTTAATAATTTTCTTCATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATAGCATTTCCCCGACTAAATAATATAAGATTTTGATTTCTACCACCTTCATTAATTTTATTATTATCTAGAAGAATAGTAAATTCAGGATCAGGAACTGGATGAACTGTATACCCACCTTTATCAAGAAGAATCTCCCATTCAGGAGCATCAGTAGATTTAACTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATCCTGGGAGCAATTAATTTTATTTCAACAATAATTAATATAAAATTAAAAGGAATAAAATTTGAACAAATACCTTTATTTGTATGAGCAGTATCATTAACTGCACTATTATTACTTCTATCATTACCCGTATTAGCAGGAGCTATTACTATACTTCTCACAGATCGTAACTTAAATACATCTTTTTTTG-